ID: 1108844182

View in Genome Browser
Species Human (GRCh38)
Location 13:54658798-54658820
Sequence CTCCGCTCGTTCTATCAACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108844180_1108844182 0 Left 1108844180 13:54658775-54658797 CCTACTCGGCCTGACAGGCTGTG No data
Right 1108844182 13:54658798-54658820 CTCCGCTCGTTCTATCAACCTGG No data
1108844177_1108844182 18 Left 1108844177 13:54658757-54658779 CCTGCTGGTCTTGTTCTGCCTAC No data
Right 1108844182 13:54658798-54658820 CTCCGCTCGTTCTATCAACCTGG No data
1108844181_1108844182 -9 Left 1108844181 13:54658784-54658806 CCTGACAGGCTGTGCTCCGCTCG No data
Right 1108844182 13:54658798-54658820 CTCCGCTCGTTCTATCAACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108844182 Original CRISPR CTCCGCTCGTTCTATCAACC TGG Intergenic