ID: 1108844183

View in Genome Browser
Species Human (GRCh38)
Location 13:54658800-54658822
Sequence ATCCAGGTTGATAGAACGAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108844183_1108844186 -7 Left 1108844183 13:54658800-54658822 CCGCTCGTTCTATCAACCTGGAT No data
Right 1108844186 13:54658816-54658838 CCTGGATCCCAGGCCTGCCAAGG No data
1108844183_1108844187 -6 Left 1108844183 13:54658800-54658822 CCGCTCGTTCTATCAACCTGGAT No data
Right 1108844187 13:54658817-54658839 CTGGATCCCAGGCCTGCCAAGGG No data
1108844183_1108844188 -1 Left 1108844183 13:54658800-54658822 CCGCTCGTTCTATCAACCTGGAT No data
Right 1108844188 13:54658822-54658844 TCCCAGGCCTGCCAAGGGCGTGG No data
1108844183_1108844193 8 Left 1108844183 13:54658800-54658822 CCGCTCGTTCTATCAACCTGGAT No data
Right 1108844193 13:54658831-54658853 TGCCAAGGGCGTGGAGTGGCAGG No data
1108844183_1108844196 10 Left 1108844183 13:54658800-54658822 CCGCTCGTTCTATCAACCTGGAT No data
Right 1108844196 13:54658833-54658855 CCAAGGGCGTGGAGTGGCAGGGG No data
1108844183_1108844191 4 Left 1108844183 13:54658800-54658822 CCGCTCGTTCTATCAACCTGGAT No data
Right 1108844191 13:54658827-54658849 GGCCTGCCAAGGGCGTGGAGTGG No data
1108844183_1108844194 9 Left 1108844183 13:54658800-54658822 CCGCTCGTTCTATCAACCTGGAT No data
Right 1108844194 13:54658832-54658854 GCCAAGGGCGTGGAGTGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108844183 Original CRISPR ATCCAGGTTGATAGAACGAG CGG (reversed) Intergenic
No off target data available for this crispr