ID: 1108844184

View in Genome Browser
Species Human (GRCh38)
Location 13:54658806-54658828
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108844180_1108844184 8 Left 1108844180 13:54658775-54658797 CCTACTCGGCCTGACAGGCTGTG No data
Right 1108844184 13:54658806-54658828 GTTCTATCAACCTGGATCCCAGG No data
1108844177_1108844184 26 Left 1108844177 13:54658757-54658779 CCTGCTGGTCTTGTTCTGCCTAC No data
Right 1108844184 13:54658806-54658828 GTTCTATCAACCTGGATCCCAGG No data
1108844181_1108844184 -1 Left 1108844181 13:54658784-54658806 CCTGACAGGCTGTGCTCCGCTCG No data
Right 1108844184 13:54658806-54658828 GTTCTATCAACCTGGATCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108844184 Original CRISPR GTTCTATCAACCTGGATCCC AGG Intergenic