ID: 1108844185

View in Genome Browser
Species Human (GRCh38)
Location 13:54658816-54658838
Sequence CCTTGGCAGGCCTGGGATCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108844185_1108844196 -6 Left 1108844185 13:54658816-54658838 CCTGGATCCCAGGCCTGCCAAGG No data
Right 1108844196 13:54658833-54658855 CCAAGGGCGTGGAGTGGCAGGGG No data
1108844185_1108844199 17 Left 1108844185 13:54658816-54658838 CCTGGATCCCAGGCCTGCCAAGG No data
Right 1108844199 13:54658856-54658878 TGCATGAGTGAATAAGTGTGGGG No data
1108844185_1108844193 -8 Left 1108844185 13:54658816-54658838 CCTGGATCCCAGGCCTGCCAAGG No data
Right 1108844193 13:54658831-54658853 TGCCAAGGGCGTGGAGTGGCAGG No data
1108844185_1108844200 22 Left 1108844185 13:54658816-54658838 CCTGGATCCCAGGCCTGCCAAGG No data
Right 1108844200 13:54658861-54658883 GAGTGAATAAGTGTGGGGTTCGG No data
1108844185_1108844194 -7 Left 1108844185 13:54658816-54658838 CCTGGATCCCAGGCCTGCCAAGG No data
Right 1108844194 13:54658832-54658854 GCCAAGGGCGTGGAGTGGCAGGG No data
1108844185_1108844198 16 Left 1108844185 13:54658816-54658838 CCTGGATCCCAGGCCTGCCAAGG No data
Right 1108844198 13:54658855-54658877 GTGCATGAGTGAATAAGTGTGGG No data
1108844185_1108844197 15 Left 1108844185 13:54658816-54658838 CCTGGATCCCAGGCCTGCCAAGG No data
Right 1108844197 13:54658854-54658876 GGTGCATGAGTGAATAAGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108844185 Original CRISPR CCTTGGCAGGCCTGGGATCC AGG (reversed) Intergenic
No off target data available for this crispr