ID: 1108844187

View in Genome Browser
Species Human (GRCh38)
Location 13:54658817-54658839
Sequence CTGGATCCCAGGCCTGCCAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108844183_1108844187 -6 Left 1108844183 13:54658800-54658822 CCGCTCGTTCTATCAACCTGGAT No data
Right 1108844187 13:54658817-54658839 CTGGATCCCAGGCCTGCCAAGGG No data
1108844181_1108844187 10 Left 1108844181 13:54658784-54658806 CCTGACAGGCTGTGCTCCGCTCG No data
Right 1108844187 13:54658817-54658839 CTGGATCCCAGGCCTGCCAAGGG No data
1108844180_1108844187 19 Left 1108844180 13:54658775-54658797 CCTACTCGGCCTGACAGGCTGTG No data
Right 1108844187 13:54658817-54658839 CTGGATCCCAGGCCTGCCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108844187 Original CRISPR CTGGATCCCAGGCCTGCCAA GGG Intergenic
No off target data available for this crispr