ID: 1108844196

View in Genome Browser
Species Human (GRCh38)
Location 13:54658833-54658855
Sequence CCAAGGGCGTGGAGTGGCAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108844183_1108844196 10 Left 1108844183 13:54658800-54658822 CCGCTCGTTCTATCAACCTGGAT No data
Right 1108844196 13:54658833-54658855 CCAAGGGCGTGGAGTGGCAGGGG No data
1108844181_1108844196 26 Left 1108844181 13:54658784-54658806 CCTGACAGGCTGTGCTCCGCTCG No data
Right 1108844196 13:54658833-54658855 CCAAGGGCGTGGAGTGGCAGGGG No data
1108844185_1108844196 -6 Left 1108844185 13:54658816-54658838 CCTGGATCCCAGGCCTGCCAAGG No data
Right 1108844196 13:54658833-54658855 CCAAGGGCGTGGAGTGGCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108844196 Original CRISPR CCAAGGGCGTGGAGTGGCAG GGG Intergenic
No off target data available for this crispr