ID: 1108848236

View in Genome Browser
Species Human (GRCh38)
Location 13:54700207-54700229
Sequence CCTTGGGGCTCTGTGGTTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108848236_1108848243 -5 Left 1108848236 13:54700207-54700229 CCAGAAACCACAGAGCCCCAAGG No data
Right 1108848243 13:54700225-54700247 CAAGGTGTGTGTGTGTGTGGAGG No data
1108848236_1108848247 -1 Left 1108848236 13:54700207-54700229 CCAGAAACCACAGAGCCCCAAGG No data
Right 1108848247 13:54700229-54700251 GTGTGTGTGTGTGTGGAGGGGGG 0: 19
1: 386
2: 1772
3: 5474
4: 15450
1108848236_1108848244 -4 Left 1108848236 13:54700207-54700229 CCAGAAACCACAGAGCCCCAAGG No data
Right 1108848244 13:54700226-54700248 AAGGTGTGTGTGTGTGTGGAGGG No data
1108848236_1108848240 -8 Left 1108848236 13:54700207-54700229 CCAGAAACCACAGAGCCCCAAGG No data
Right 1108848240 13:54700222-54700244 CCCCAAGGTGTGTGTGTGTGTGG No data
1108848236_1108848246 -2 Left 1108848236 13:54700207-54700229 CCAGAAACCACAGAGCCCCAAGG No data
Right 1108848246 13:54700228-54700250 GGTGTGTGTGTGTGTGGAGGGGG No data
1108848236_1108848245 -3 Left 1108848236 13:54700207-54700229 CCAGAAACCACAGAGCCCCAAGG No data
Right 1108848245 13:54700227-54700249 AGGTGTGTGTGTGTGTGGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108848236 Original CRISPR CCTTGGGGCTCTGTGGTTTC TGG (reversed) Intergenic
No off target data available for this crispr