ID: 1108848274

View in Genome Browser
Species Human (GRCh38)
Location 13:54700379-54700401
Sequence CAAAGCCATCTGGACTACCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108848262_1108848274 26 Left 1108848262 13:54700330-54700352 CCATGGTTTCTGGGCTGACCCAG No data
Right 1108848274 13:54700379-54700401 CAAAGCCATCTGGACTACCTGGG No data
1108848266_1108848274 2 Left 1108848266 13:54700354-54700376 CCCACCACCACTTCCTGTTGAAA No data
Right 1108848274 13:54700379-54700401 CAAAGCCATCTGGACTACCTGGG No data
1108848263_1108848274 8 Left 1108848263 13:54700348-54700370 CCCAGCCCCACCACCACTTCCTG No data
Right 1108848274 13:54700379-54700401 CAAAGCCATCTGGACTACCTGGG No data
1108848264_1108848274 7 Left 1108848264 13:54700349-54700371 CCAGCCCCACCACCACTTCCTGT No data
Right 1108848274 13:54700379-54700401 CAAAGCCATCTGGACTACCTGGG No data
1108848265_1108848274 3 Left 1108848265 13:54700353-54700375 CCCCACCACCACTTCCTGTTGAA No data
Right 1108848274 13:54700379-54700401 CAAAGCCATCTGGACTACCTGGG No data
1108848267_1108848274 1 Left 1108848267 13:54700355-54700377 CCACCACCACTTCCTGTTGAAAG No data
Right 1108848274 13:54700379-54700401 CAAAGCCATCTGGACTACCTGGG No data
1108848269_1108848274 -2 Left 1108848269 13:54700358-54700380 CCACCACTTCCTGTTGAAAGGCA No data
Right 1108848274 13:54700379-54700401 CAAAGCCATCTGGACTACCTGGG No data
1108848270_1108848274 -5 Left 1108848270 13:54700361-54700383 CCACTTCCTGTTGAAAGGCAAAG No data
Right 1108848274 13:54700379-54700401 CAAAGCCATCTGGACTACCTGGG No data
1108848261_1108848274 27 Left 1108848261 13:54700329-54700351 CCCATGGTTTCTGGGCTGACCCA No data
Right 1108848274 13:54700379-54700401 CAAAGCCATCTGGACTACCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108848274 Original CRISPR CAAAGCCATCTGGACTACCT GGG Intergenic
No off target data available for this crispr