ID: 1108848824

View in Genome Browser
Species Human (GRCh38)
Location 13:54704096-54704118
Sequence GTATAGGGGTTGGGTAAAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108848824_1108848833 11 Left 1108848824 13:54704096-54704118 CCAGTTTTACCCAACCCCTATAC No data
Right 1108848833 13:54704130-54704152 AAATACCAGAGGAAGCAGAATGG 0: 94
1: 127
2: 47
3: 56
4: 512
1108848824_1108848835 24 Left 1108848824 13:54704096-54704118 CCAGTTTTACCCAACCCCTATAC No data
Right 1108848835 13:54704143-54704165 AGCAGAATGGTTCACTATTCTGG No data
1108848824_1108848832 0 Left 1108848824 13:54704096-54704118 CCAGTTTTACCCAACCCCTATAC No data
Right 1108848832 13:54704119-54704141 CCTGCTCTCTCAAATACCAGAGG 0: 76
1: 60
2: 40
3: 92
4: 201

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108848824 Original CRISPR GTATAGGGGTTGGGTAAAAC TGG (reversed) Intergenic
No off target data available for this crispr