ID: 1108853236

View in Genome Browser
Species Human (GRCh38)
Location 13:54761870-54761892
Sequence TTGGTTCCACAGCATGGGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108853236_1108853244 27 Left 1108853236 13:54761870-54761892 CCATGCCCATGCTGTGGAACCAA No data
Right 1108853244 13:54761920-54761942 CAGAGAGTTTATATTTAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108853236 Original CRISPR TTGGTTCCACAGCATGGGCA TGG (reversed) Intergenic
No off target data available for this crispr