ID: 1108861224

View in Genome Browser
Species Human (GRCh38)
Location 13:54861796-54861818
Sequence CTAGCATTCAACATCAATAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108861224_1108861228 -3 Left 1108861224 13:54861796-54861818 CCCTTATTGATGTTGAATGCTAG No data
Right 1108861228 13:54861816-54861838 TAGAAAATACTGTGAGGCAAGGG No data
1108861224_1108861226 -9 Left 1108861224 13:54861796-54861818 CCCTTATTGATGTTGAATGCTAG No data
Right 1108861226 13:54861810-54861832 GAATGCTAGAAAATACTGTGAGG No data
1108861224_1108861227 -4 Left 1108861224 13:54861796-54861818 CCCTTATTGATGTTGAATGCTAG No data
Right 1108861227 13:54861815-54861837 CTAGAAAATACTGTGAGGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108861224 Original CRISPR CTAGCATTCAACATCAATAA GGG (reversed) Intergenic
No off target data available for this crispr