ID: 1108863144

View in Genome Browser
Species Human (GRCh38)
Location 13:54887603-54887625
Sequence CAATAAGCCCACATTGACAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108863144_1108863145 16 Left 1108863144 13:54887603-54887625 CCTATGTCAATGTGGGCTTATTG No data
Right 1108863145 13:54887642-54887664 CAAATGTTACTATATATAAAAGG No data
1108863144_1108863146 23 Left 1108863144 13:54887603-54887625 CCTATGTCAATGTGGGCTTATTG No data
Right 1108863146 13:54887649-54887671 TACTATATATAAAAGGTCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108863144 Original CRISPR CAATAAGCCCACATTGACAT AGG (reversed) Intergenic
No off target data available for this crispr