ID: 1108866517

View in Genome Browser
Species Human (GRCh38)
Location 13:54930431-54930453
Sequence ATGTAGTTAAGGTAGGGATC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108866510_1108866517 23 Left 1108866510 13:54930385-54930407 CCAAAGCCTCAGAATGTAATCTT No data
Right 1108866517 13:54930431-54930453 ATGTAGTTAAGGTAGGGATCAGG No data
1108866509_1108866517 24 Left 1108866509 13:54930384-54930406 CCCAAAGCCTCAGAATGTAATCT No data
Right 1108866517 13:54930431-54930453 ATGTAGTTAAGGTAGGGATCAGG No data
1108866511_1108866517 17 Left 1108866511 13:54930391-54930413 CCTCAGAATGTAATCTTATTTGG No data
Right 1108866517 13:54930431-54930453 ATGTAGTTAAGGTAGGGATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108866517 Original CRISPR ATGTAGTTAAGGTAGGGATC AGG Intergenic
No off target data available for this crispr