ID: 1108873639

View in Genome Browser
Species Human (GRCh38)
Location 13:55018256-55018278
Sequence GACACACTCTTTACATGGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108873639_1108873643 17 Left 1108873639 13:55018256-55018278 CCAGTCCATGTAAAGAGTGTGTC No data
Right 1108873643 13:55018296-55018318 AAGAGATTAGTGTGGAGAGAAGG No data
1108873639_1108873642 9 Left 1108873639 13:55018256-55018278 CCAGTCCATGTAAAGAGTGTGTC No data
Right 1108873642 13:55018288-55018310 ATTTGCTAAAGAGATTAGTGTGG No data
1108873639_1108873644 25 Left 1108873639 13:55018256-55018278 CCAGTCCATGTAAAGAGTGTGTC No data
Right 1108873644 13:55018304-55018326 AGTGTGGAGAGAAGGATACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108873639 Original CRISPR GACACACTCTTTACATGGAC TGG (reversed) Intergenic
No off target data available for this crispr