ID: 1108888238

View in Genome Browser
Species Human (GRCh38)
Location 13:55218608-55218630
Sequence CTCAATTAGCAAAAGCAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108888234_1108888238 23 Left 1108888234 13:55218562-55218584 CCTCTGTATATCAGTAAAACAAC No data
Right 1108888238 13:55218608-55218630 CTCAATTAGCAAAAGCAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108888238 Original CRISPR CTCAATTAGCAAAAGCAGAG AGG Intergenic
No off target data available for this crispr