ID: 1108891587

View in Genome Browser
Species Human (GRCh38)
Location 13:55267276-55267298
Sequence TGTTACCTAATTAAAGTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108891584_1108891587 -1 Left 1108891584 13:55267254-55267276 CCTACATAGGAGTGAAGACAAAT No data
Right 1108891587 13:55267276-55267298 TGTTACCTAATTAAAGTGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108891587 Original CRISPR TGTTACCTAATTAAAGTGGG TGG Intergenic
No off target data available for this crispr