ID: 1108893511

View in Genome Browser
Species Human (GRCh38)
Location 13:55293998-55294020
Sequence TACCTGAGACTTCTGTAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108893511_1108893513 11 Left 1108893511 13:55293998-55294020 CCAGGCTACAGAAGTCTCAGGTA No data
Right 1108893513 13:55294032-55294054 ATTATCAGGAACTGAAGCAAAGG No data
1108893511_1108893512 -3 Left 1108893511 13:55293998-55294020 CCAGGCTACAGAAGTCTCAGGTA No data
Right 1108893512 13:55294018-55294040 GTAGAAATGAGAAAATTATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108893511 Original CRISPR TACCTGAGACTTCTGTAGCC TGG (reversed) Intergenic
No off target data available for this crispr