ID: 1108898324

View in Genome Browser
Species Human (GRCh38)
Location 13:55363892-55363914
Sequence TTACTATTAGTTTGGATCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108898324_1108898326 25 Left 1108898324 13:55363892-55363914 CCAGGGATCCAAACTAATAGTAA No data
Right 1108898326 13:55363940-55363962 TAAACGATATGTTTTACAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108898324 Original CRISPR TTACTATTAGTTTGGATCCC TGG (reversed) Intergenic
No off target data available for this crispr