ID: 1108900736

View in Genome Browser
Species Human (GRCh38)
Location 13:55404432-55404454
Sequence ACCCACCTTCATCACCCCTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108900736_1108900749 28 Left 1108900736 13:55404432-55404454 CCCTAGGGGTGATGAAGGTGGGT No data
Right 1108900749 13:55404483-55404505 GAGAAGGGAAGGTATTGGAGGGG No data
1108900736_1108900744 17 Left 1108900736 13:55404432-55404454 CCCTAGGGGTGATGAAGGTGGGT No data
Right 1108900744 13:55404472-55404494 TGTGAAAGCCTGAGAAGGGAAGG No data
1108900736_1108900745 23 Left 1108900736 13:55404432-55404454 CCCTAGGGGTGATGAAGGTGGGT No data
Right 1108900745 13:55404478-55404500 AGCCTGAGAAGGGAAGGTATTGG No data
1108900736_1108900747 26 Left 1108900736 13:55404432-55404454 CCCTAGGGGTGATGAAGGTGGGT No data
Right 1108900747 13:55404481-55404503 CTGAGAAGGGAAGGTATTGGAGG No data
1108900736_1108900750 29 Left 1108900736 13:55404432-55404454 CCCTAGGGGTGATGAAGGTGGGT No data
Right 1108900750 13:55404484-55404506 AGAAGGGAAGGTATTGGAGGGGG No data
1108900736_1108900742 12 Left 1108900736 13:55404432-55404454 CCCTAGGGGTGATGAAGGTGGGT No data
Right 1108900742 13:55404467-55404489 TGAAGTGTGAAAGCCTGAGAAGG No data
1108900736_1108900743 13 Left 1108900736 13:55404432-55404454 CCCTAGGGGTGATGAAGGTGGGT No data
Right 1108900743 13:55404468-55404490 GAAGTGTGAAAGCCTGAGAAGGG No data
1108900736_1108900748 27 Left 1108900736 13:55404432-55404454 CCCTAGGGGTGATGAAGGTGGGT No data
Right 1108900748 13:55404482-55404504 TGAGAAGGGAAGGTATTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108900736 Original CRISPR ACCCACCTTCATCACCCCTA GGG (reversed) Intergenic