ID: 1108903938

View in Genome Browser
Species Human (GRCh38)
Location 13:55447293-55447315
Sequence GGTCCCAGTGGGTCTCCTAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108903933_1108903938 10 Left 1108903933 13:55447260-55447282 CCCTGTTTGCTTCTAGACTTATA No data
Right 1108903938 13:55447293-55447315 GGTCCCAGTGGGTCTCCTAGAGG No data
1108903930_1108903938 23 Left 1108903930 13:55447247-55447269 CCACCTGCAAAACCCCTGTTTGC No data
Right 1108903938 13:55447293-55447315 GGTCCCAGTGGGTCTCCTAGAGG No data
1108903931_1108903938 20 Left 1108903931 13:55447250-55447272 CCTGCAAAACCCCTGTTTGCTTC No data
Right 1108903938 13:55447293-55447315 GGTCCCAGTGGGTCTCCTAGAGG No data
1108903932_1108903938 11 Left 1108903932 13:55447259-55447281 CCCCTGTTTGCTTCTAGACTTAT No data
Right 1108903938 13:55447293-55447315 GGTCCCAGTGGGTCTCCTAGAGG No data
1108903934_1108903938 9 Left 1108903934 13:55447261-55447283 CCTGTTTGCTTCTAGACTTATAA No data
Right 1108903938 13:55447293-55447315 GGTCCCAGTGGGTCTCCTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108903938 Original CRISPR GGTCCCAGTGGGTCTCCTAG AGG Intergenic
No off target data available for this crispr