ID: 1108904275

View in Genome Browser
Species Human (GRCh38)
Location 13:55449944-55449966
Sequence AGTTATTTGCAGAAGATGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108904275_1108904279 22 Left 1108904275 13:55449944-55449966 CCTGCCATCTTCTGCAAATAACT No data
Right 1108904279 13:55449989-55450011 CTTGGCCTGTTACTGAGCTTTGG No data
1108904275_1108904280 25 Left 1108904275 13:55449944-55449966 CCTGCCATCTTCTGCAAATAACT No data
Right 1108904280 13:55449992-55450014 GGCCTGTTACTGAGCTTTGGTGG No data
1108904275_1108904277 4 Left 1108904275 13:55449944-55449966 CCTGCCATCTTCTGCAAATAACT No data
Right 1108904277 13:55449971-55449993 TCCTTTTGAGAGACAGCTCTTGG 0: 181
1: 197
2: 163
3: 130
4: 293

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108904275 Original CRISPR AGTTATTTGCAGAAGATGGC AGG (reversed) Intergenic
No off target data available for this crispr