ID: 1108908281

View in Genome Browser
Species Human (GRCh38)
Location 13:55507397-55507419
Sequence CTTTCAACACTGTTTGATGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108908281_1108908286 11 Left 1108908281 13:55507397-55507419 CCTCCATCAAACAGTGTTGAAAG No data
Right 1108908286 13:55507431-55507453 GAGAGATGTTTTGATCATGAAGG No data
1108908281_1108908287 29 Left 1108908281 13:55507397-55507419 CCTCCATCAAACAGTGTTGAAAG No data
Right 1108908287 13:55507449-55507471 GAAGGCTCTCCTCTCATGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108908281 Original CRISPR CTTTCAACACTGTTTGATGG AGG (reversed) Intergenic
No off target data available for this crispr