ID: 1108909213

View in Genome Browser
Species Human (GRCh38)
Location 13:55521818-55521840
Sequence AGTCAACGGCTTCAAAGGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108909213_1108909217 8 Left 1108909213 13:55521818-55521840 CCTGTCCTTTGAAGCCGTTGACT No data
Right 1108909217 13:55521849-55521871 CTAGCTATAAAATTCCTAGATGG No data
1108909213_1108909219 28 Left 1108909213 13:55521818-55521840 CCTGTCCTTTGAAGCCGTTGACT No data
Right 1108909219 13:55521869-55521891 TGGCATCTTCTTCCAATAGAAGG 0: 162
1: 436
2: 527
3: 458
4: 416

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108909213 Original CRISPR AGTCAACGGCTTCAAAGGAC AGG (reversed) Intergenic
No off target data available for this crispr