ID: 1108910625

View in Genome Browser
Species Human (GRCh38)
Location 13:55546622-55546644
Sequence CCTAACATGTTTCCCAAAAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108910625_1108910631 30 Left 1108910625 13:55546622-55546644 CCTATTTTGGGAAACATGTTAGG No data
Right 1108910631 13:55546675-55546697 AAACAGAAATGGAGTCAGGGTGG No data
1108910625_1108910628 19 Left 1108910625 13:55546622-55546644 CCTATTTTGGGAAACATGTTAGG No data
Right 1108910628 13:55546664-55546686 AAAAAATTACTAAACAGAAATGG No data
1108910625_1108910630 27 Left 1108910625 13:55546622-55546644 CCTATTTTGGGAAACATGTTAGG No data
Right 1108910630 13:55546672-55546694 ACTAAACAGAAATGGAGTCAGGG No data
1108910625_1108910629 26 Left 1108910625 13:55546622-55546644 CCTATTTTGGGAAACATGTTAGG No data
Right 1108910629 13:55546671-55546693 TACTAAACAGAAATGGAGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108910625 Original CRISPR CCTAACATGTTTCCCAAAAT AGG (reversed) Intergenic
No off target data available for this crispr