ID: 1108910838

View in Genome Browser
Species Human (GRCh38)
Location 13:55549862-55549884
Sequence AAGTTGTAGGAGAGGCCTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108910829_1108910838 12 Left 1108910829 13:55549827-55549849 CCTCACCCAACTCTCATGTGAAA No data
Right 1108910838 13:55549862-55549884 AAGTTGTAGGAGAGGCCTGGTGG No data
1108910831_1108910838 6 Left 1108910831 13:55549833-55549855 CCAACTCTCATGTGAAATTGTAA No data
Right 1108910838 13:55549862-55549884 AAGTTGTAGGAGAGGCCTGGTGG No data
1108910830_1108910838 7 Left 1108910830 13:55549832-55549854 CCCAACTCTCATGTGAAATTGTA No data
Right 1108910838 13:55549862-55549884 AAGTTGTAGGAGAGGCCTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108910838 Original CRISPR AAGTTGTAGGAGAGGCCTGG TGG Intergenic
No off target data available for this crispr