ID: 1108911420

View in Genome Browser
Species Human (GRCh38)
Location 13:55556664-55556686
Sequence GTTCTCAGTGGAATACCATG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108911417_1108911420 7 Left 1108911417 13:55556634-55556656 CCCAAATAACATTGAGTAAAAGT No data
Right 1108911420 13:55556664-55556686 GTTCTCAGTGGAATACCATGAGG No data
1108911418_1108911420 6 Left 1108911418 13:55556635-55556657 CCAAATAACATTGAGTAAAAGTA No data
Right 1108911420 13:55556664-55556686 GTTCTCAGTGGAATACCATGAGG No data
1108911416_1108911420 12 Left 1108911416 13:55556629-55556651 CCTTACCCAAATAACATTGAGTA No data
Right 1108911420 13:55556664-55556686 GTTCTCAGTGGAATACCATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108911420 Original CRISPR GTTCTCAGTGGAATACCATG AGG Intergenic
No off target data available for this crispr