ID: 1108912655

View in Genome Browser
Species Human (GRCh38)
Location 13:55576680-55576702
Sequence ATGCCAGGGAATTCTACTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108912655_1108912670 22 Left 1108912655 13:55576680-55576702 CCCCCAGTAGAATTCCCTGGCAT No data
Right 1108912670 13:55576725-55576747 ACAATGGTGGCTGGACCCGATGG No data
1108912655_1108912667 6 Left 1108912655 13:55576680-55576702 CCCCCAGTAGAATTCCCTGGCAT No data
Right 1108912667 13:55576709-55576731 GGAGGGCTTCAGTGGCACAATGG No data
1108912655_1108912664 -2 Left 1108912655 13:55576680-55576702 CCCCCAGTAGAATTCCCTGGCAT No data
Right 1108912664 13:55576701-55576723 ATCCACCTGGAGGGCTTCAGTGG No data
1108912655_1108912669 13 Left 1108912655 13:55576680-55576702 CCCCCAGTAGAATTCCCTGGCAT No data
Right 1108912669 13:55576716-55576738 TTCAGTGGCACAATGGTGGCTGG No data
1108912655_1108912671 30 Left 1108912655 13:55576680-55576702 CCCCCAGTAGAATTCCCTGGCAT No data
Right 1108912671 13:55576733-55576755 GGCTGGACCCGATGGTGTTGTGG No data
1108912655_1108912668 9 Left 1108912655 13:55576680-55576702 CCCCCAGTAGAATTCCCTGGCAT No data
Right 1108912668 13:55576712-55576734 GGGCTTCAGTGGCACAATGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108912655 Original CRISPR ATGCCAGGGAATTCTACTGG GGG (reversed) Intergenic