ID: 1108914064

View in Genome Browser
Species Human (GRCh38)
Location 13:55587081-55587103
Sequence GCCCTGTGATTAAGTTCAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108914064_1108914067 5 Left 1108914064 13:55587081-55587103 CCCCTTGAACTTAATCACAGGGC No data
Right 1108914067 13:55587109-55587131 AATACTAAGAGATGACCTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108914064 Original CRISPR GCCCTGTGATTAAGTTCAAG GGG (reversed) Intergenic
No off target data available for this crispr