ID: 1108914305

View in Genome Browser
Species Human (GRCh38)
Location 13:55588898-55588920
Sequence ACTTATCTGCAGGAGATGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108914302_1108914305 4 Left 1108914302 13:55588871-55588893 CCAAGAGCTGTCTTTCAAAAGGA 0: 7
1: 195
2: 205
3: 190
4: 402
Right 1108914305 13:55588898-55588920 ACTTATCTGCAGGAGATGGCAGG No data
1108914299_1108914305 22 Left 1108914299 13:55588853-55588875 CCAAAGCCTAGTAACATGCCAAG No data
Right 1108914305 13:55588898-55588920 ACTTATCTGCAGGAGATGGCAGG No data
1108914300_1108914305 16 Left 1108914300 13:55588859-55588881 CCTAGTAACATGCCAAGAGCTGT No data
Right 1108914305 13:55588898-55588920 ACTTATCTGCAGGAGATGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108914305 Original CRISPR ACTTATCTGCAGGAGATGGC AGG Intergenic
No off target data available for this crispr