ID: 1108915738

View in Genome Browser
Species Human (GRCh38)
Location 13:55608680-55608702
Sequence ACCAAAAATATTTCCAGACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108915738_1108915739 16 Left 1108915738 13:55608680-55608702 CCATGTCTGGAAATATTTTTGGT No data
Right 1108915739 13:55608719-55608741 TACTAGAAACTATTGAGTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108915738 Original CRISPR ACCAAAAATATTTCCAGACA TGG (reversed) Intergenic
No off target data available for this crispr