ID: 1108918160

View in Genome Browser
Species Human (GRCh38)
Location 13:55641881-55641903
Sequence GACTTCCACCAGAAGAACTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108918160_1108918163 5 Left 1108918160 13:55641881-55641903 CCCTAGTTCTTCTGGTGGAAGTC No data
Right 1108918163 13:55641909-55641931 TTCGATACACCACCATAATAGGG No data
1108918160_1108918162 4 Left 1108918160 13:55641881-55641903 CCCTAGTTCTTCTGGTGGAAGTC No data
Right 1108918162 13:55641908-55641930 TTTCGATACACCACCATAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108918160 Original CRISPR GACTTCCACCAGAAGAACTA GGG (reversed) Intergenic
No off target data available for this crispr