ID: 1108920112

View in Genome Browser
Species Human (GRCh38)
Location 13:55662402-55662424
Sequence GACACTGCTCTGTTCATGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108920112_1108920117 21 Left 1108920112 13:55662402-55662424 CCCACCATGAACAGAGCAGTGTC No data
Right 1108920117 13:55662446-55662468 AATCCCAGTAACCTGTGACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108920112 Original CRISPR GACACTGCTCTGTTCATGGT GGG (reversed) Intergenic
No off target data available for this crispr