ID: 1108921993

View in Genome Browser
Species Human (GRCh38)
Location 13:55687487-55687509
Sequence CACTGCTGTCACCTTAATTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108921993_1108921997 3 Left 1108921993 13:55687487-55687509 CCAAAATTAAGGTGACAGCAGTG No data
Right 1108921997 13:55687513-55687535 CGCTCCTTTTGGTGACTCTAGGG No data
1108921993_1108921994 -8 Left 1108921993 13:55687487-55687509 CCAAAATTAAGGTGACAGCAGTG No data
Right 1108921994 13:55687502-55687524 CAGCAGTGCCACGCTCCTTTTGG No data
1108921993_1108921998 4 Left 1108921993 13:55687487-55687509 CCAAAATTAAGGTGACAGCAGTG No data
Right 1108921998 13:55687514-55687536 GCTCCTTTTGGTGACTCTAGGGG No data
1108921993_1108921996 2 Left 1108921993 13:55687487-55687509 CCAAAATTAAGGTGACAGCAGTG No data
Right 1108921996 13:55687512-55687534 ACGCTCCTTTTGGTGACTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108921993 Original CRISPR CACTGCTGTCACCTTAATTT TGG (reversed) Intergenic
No off target data available for this crispr