ID: 1108921995

View in Genome Browser
Species Human (GRCh38)
Location 13:55687510-55687532
Sequence TAGAGTCACCAAAAGGAGCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108921995_1108922000 11 Left 1108921995 13:55687510-55687532 CCACGCTCCTTTTGGTGACTCTA No data
Right 1108922000 13:55687544-55687566 TCCCTTGCTCTTACAGTTTCTGG No data
1108921995_1108922003 14 Left 1108921995 13:55687510-55687532 CCACGCTCCTTTTGGTGACTCTA No data
Right 1108922003 13:55687547-55687569 CTTGCTCTTACAGTTTCTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108921995 Original CRISPR TAGAGTCACCAAAAGGAGCG TGG (reversed) Intergenic
No off target data available for this crispr