ID: 1108935893

View in Genome Browser
Species Human (GRCh38)
Location 13:55879381-55879403
Sequence AAATAGCCAGAGATGGATAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108935893_1108935899 8 Left 1108935893 13:55879381-55879403 CCTTTATCCATCTCTGGCTATTT No data
Right 1108935899 13:55879412-55879434 GTAGAATGGAACCACAGATTGGG No data
1108935893_1108935898 7 Left 1108935893 13:55879381-55879403 CCTTTATCCATCTCTGGCTATTT No data
Right 1108935898 13:55879411-55879433 GGTAGAATGGAACCACAGATTGG No data
1108935893_1108935896 -6 Left 1108935893 13:55879381-55879403 CCTTTATCCATCTCTGGCTATTT No data
Right 1108935896 13:55879398-55879420 CTATTTGCCTCATGGTAGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108935893 Original CRISPR AAATAGCCAGAGATGGATAA AGG (reversed) Intergenic
No off target data available for this crispr