ID: 1108936362

View in Genome Browser
Species Human (GRCh38)
Location 13:55886017-55886039
Sequence CTAATTTTCCAGCACTGCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108936362_1108936363 -10 Left 1108936362 13:55886017-55886039 CCACTGCAGTGCTGGAAAATTAG No data
Right 1108936363 13:55886030-55886052 GGAAAATTAGTTAGATTCTGAGG No data
1108936362_1108936365 21 Left 1108936362 13:55886017-55886039 CCACTGCAGTGCTGGAAAATTAG No data
Right 1108936365 13:55886061-55886083 AAGATATTCTTGTCCATGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108936362 Original CRISPR CTAATTTTCCAGCACTGCAG TGG (reversed) Intergenic
No off target data available for this crispr