ID: 1108936962

View in Genome Browser
Species Human (GRCh38)
Location 13:55893480-55893502
Sequence GAAGCATCTGAGACCTTTTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108936962_1108936966 17 Left 1108936962 13:55893480-55893502 CCATAAAAGGTCTCAGATGCTTC No data
Right 1108936966 13:55893520-55893542 ACAGAAATAAGTGTTTTATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108936962 Original CRISPR GAAGCATCTGAGACCTTTTA TGG (reversed) Intergenic
No off target data available for this crispr