ID: 1108939314

View in Genome Browser
Species Human (GRCh38)
Location 13:55932497-55932519
Sequence AGTTTGGGATAGCACTTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108939314_1108939319 -6 Left 1108939314 13:55932497-55932519 CCTCCCAAGTGCTATCCCAAACT No data
Right 1108939319 13:55932514-55932536 CAAACTTTATTCCTATGTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108939314 Original CRISPR AGTTTGGGATAGCACTTGGG AGG (reversed) Intergenic
No off target data available for this crispr