ID: 1108939509

View in Genome Browser
Species Human (GRCh38)
Location 13:55935398-55935420
Sequence ATATGCCAGAGGGCCCAGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108939504_1108939509 19 Left 1108939504 13:55935356-55935378 CCCATACGGGGACTGGCAAGAGA No data
Right 1108939509 13:55935398-55935420 ATATGCCAGAGGGCCCAGTTTGG No data
1108939505_1108939509 18 Left 1108939505 13:55935357-55935379 CCATACGGGGACTGGCAAGAGAC No data
Right 1108939509 13:55935398-55935420 ATATGCCAGAGGGCCCAGTTTGG No data
1108939503_1108939509 20 Left 1108939503 13:55935355-55935377 CCCCATACGGGGACTGGCAAGAG No data
Right 1108939509 13:55935398-55935420 ATATGCCAGAGGGCCCAGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108939509 Original CRISPR ATATGCCAGAGGGCCCAGTT TGG Intergenic
No off target data available for this crispr