ID: 1108944856

View in Genome Browser
Species Human (GRCh38)
Location 13:56009376-56009398
Sequence TTATTTTTCTTATGGACAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108944853_1108944856 1 Left 1108944853 13:56009352-56009374 CCAGAAAATATAATCGTTATTTA No data
Right 1108944856 13:56009376-56009398 TTATTTTTCTTATGGACAAAGGG No data
1108944852_1108944856 6 Left 1108944852 13:56009347-56009369 CCTGGCCAGAAAATATAATCGTT No data
Right 1108944856 13:56009376-56009398 TTATTTTTCTTATGGACAAAGGG No data
1108944851_1108944856 14 Left 1108944851 13:56009339-56009361 CCAACAAACCTGGCCAGAAAATA No data
Right 1108944856 13:56009376-56009398 TTATTTTTCTTATGGACAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108944856 Original CRISPR TTATTTTTCTTATGGACAAA GGG Intergenic
No off target data available for this crispr