ID: 1108948963

View in Genome Browser
Species Human (GRCh38)
Location 13:56063150-56063172
Sequence AAGAGTGGCTAGCAAGTAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108948960_1108948963 -9 Left 1108948960 13:56063136-56063158 CCTCCAGTGACTTTAAGAGTGGC No data
Right 1108948963 13:56063150-56063172 AAGAGTGGCTAGCAAGTAGAGGG No data
1108948957_1108948963 0 Left 1108948957 13:56063127-56063149 CCTCCTGTTCCTCCAGTGACTTT No data
Right 1108948963 13:56063150-56063172 AAGAGTGGCTAGCAAGTAGAGGG No data
1108948958_1108948963 -3 Left 1108948958 13:56063130-56063152 CCTGTTCCTCCAGTGACTTTAAG No data
Right 1108948963 13:56063150-56063172 AAGAGTGGCTAGCAAGTAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108948963 Original CRISPR AAGAGTGGCTAGCAAGTAGA GGG Intergenic
No off target data available for this crispr