ID: 1108961310

View in Genome Browser
Species Human (GRCh38)
Location 13:56235228-56235250
Sequence CATGTATTTCACATCTTTAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108961310_1108961311 16 Left 1108961310 13:56235228-56235250 CCTATAAAGATGTGAAATACATG No data
Right 1108961311 13:56235267-56235289 TGAAATGTAAACCAGACCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108961310 Original CRISPR CATGTATTTCACATCTTTAT AGG (reversed) Intergenic
No off target data available for this crispr