ID: 1108968194

View in Genome Browser
Species Human (GRCh38)
Location 13:56339169-56339191
Sequence GGCTGTTGATTCAGGCATGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108968194_1108968209 22 Left 1108968194 13:56339169-56339191 CCCCCATGCCTGAATCAACAGCC No data
Right 1108968209 13:56339214-56339236 GCATGGATCCTAGTGAAAGGGGG No data
1108968194_1108968208 21 Left 1108968194 13:56339169-56339191 CCCCCATGCCTGAATCAACAGCC No data
Right 1108968208 13:56339213-56339235 TGCATGGATCCTAGTGAAAGGGG No data
1108968194_1108968207 20 Left 1108968194 13:56339169-56339191 CCCCCATGCCTGAATCAACAGCC No data
Right 1108968207 13:56339212-56339234 GTGCATGGATCCTAGTGAAAGGG No data
1108968194_1108968200 5 Left 1108968194 13:56339169-56339191 CCCCCATGCCTGAATCAACAGCC No data
Right 1108968200 13:56339197-56339219 TACCCCACCTTTCCTGTGCATGG No data
1108968194_1108968206 19 Left 1108968194 13:56339169-56339191 CCCCCATGCCTGAATCAACAGCC No data
Right 1108968206 13:56339211-56339233 TGTGCATGGATCCTAGTGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108968194 Original CRISPR GGCTGTTGATTCAGGCATGG GGG (reversed) Intergenic