ID: 1108968195

View in Genome Browser
Species Human (GRCh38)
Location 13:56339170-56339192
Sequence AGGCTGTTGATTCAGGCATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108968195_1108968208 20 Left 1108968195 13:56339170-56339192 CCCCATGCCTGAATCAACAGCCT No data
Right 1108968208 13:56339213-56339235 TGCATGGATCCTAGTGAAAGGGG No data
1108968195_1108968200 4 Left 1108968195 13:56339170-56339192 CCCCATGCCTGAATCAACAGCCT No data
Right 1108968200 13:56339197-56339219 TACCCCACCTTTCCTGTGCATGG No data
1108968195_1108968209 21 Left 1108968195 13:56339170-56339192 CCCCATGCCTGAATCAACAGCCT No data
Right 1108968209 13:56339214-56339236 GCATGGATCCTAGTGAAAGGGGG No data
1108968195_1108968206 18 Left 1108968195 13:56339170-56339192 CCCCATGCCTGAATCAACAGCCT No data
Right 1108968206 13:56339211-56339233 TGTGCATGGATCCTAGTGAAAGG No data
1108968195_1108968207 19 Left 1108968195 13:56339170-56339192 CCCCATGCCTGAATCAACAGCCT No data
Right 1108968207 13:56339212-56339234 GTGCATGGATCCTAGTGAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108968195 Original CRISPR AGGCTGTTGATTCAGGCATG GGG (reversed) Intergenic