ID: 1108968198

View in Genome Browser
Species Human (GRCh38)
Location 13:56339177-56339199
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108968198_1108968208 13 Left 1108968198 13:56339177-56339199 CCTGAATCAACAGCCTGAGTTAC No data
Right 1108968208 13:56339213-56339235 TGCATGGATCCTAGTGAAAGGGG No data
1108968198_1108968207 12 Left 1108968198 13:56339177-56339199 CCTGAATCAACAGCCTGAGTTAC No data
Right 1108968207 13:56339212-56339234 GTGCATGGATCCTAGTGAAAGGG No data
1108968198_1108968206 11 Left 1108968198 13:56339177-56339199 CCTGAATCAACAGCCTGAGTTAC No data
Right 1108968206 13:56339211-56339233 TGTGCATGGATCCTAGTGAAAGG No data
1108968198_1108968209 14 Left 1108968198 13:56339177-56339199 CCTGAATCAACAGCCTGAGTTAC No data
Right 1108968209 13:56339214-56339236 GCATGGATCCTAGTGAAAGGGGG No data
1108968198_1108968200 -3 Left 1108968198 13:56339177-56339199 CCTGAATCAACAGCCTGAGTTAC No data
Right 1108968200 13:56339197-56339219 TACCCCACCTTTCCTGTGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108968198 Original CRISPR GTAACTCAGGCTGTTGATTC AGG (reversed) Intergenic