ID: 1108968206

View in Genome Browser
Species Human (GRCh38)
Location 13:56339211-56339233
Sequence TGTGCATGGATCCTAGTGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108968195_1108968206 18 Left 1108968195 13:56339170-56339192 CCCCATGCCTGAATCAACAGCCT No data
Right 1108968206 13:56339211-56339233 TGTGCATGGATCCTAGTGAAAGG No data
1108968194_1108968206 19 Left 1108968194 13:56339169-56339191 CCCCCATGCCTGAATCAACAGCC No data
Right 1108968206 13:56339211-56339233 TGTGCATGGATCCTAGTGAAAGG No data
1108968198_1108968206 11 Left 1108968198 13:56339177-56339199 CCTGAATCAACAGCCTGAGTTAC No data
Right 1108968206 13:56339211-56339233 TGTGCATGGATCCTAGTGAAAGG No data
1108968199_1108968206 -2 Left 1108968199 13:56339190-56339212 CCTGAGTTACCCCACCTTTCCTG No data
Right 1108968206 13:56339211-56339233 TGTGCATGGATCCTAGTGAAAGG No data
1108968196_1108968206 17 Left 1108968196 13:56339171-56339193 CCCATGCCTGAATCAACAGCCTG No data
Right 1108968206 13:56339211-56339233 TGTGCATGGATCCTAGTGAAAGG No data
1108968197_1108968206 16 Left 1108968197 13:56339172-56339194 CCATGCCTGAATCAACAGCCTGA No data
Right 1108968206 13:56339211-56339233 TGTGCATGGATCCTAGTGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108968206 Original CRISPR TGTGCATGGATCCTAGTGAA AGG Intergenic