ID: 1108970932

View in Genome Browser
Species Human (GRCh38)
Location 13:56375635-56375657
Sequence TTTCTAATCAAACTAAAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108970930_1108970932 7 Left 1108970930 13:56375605-56375627 CCATAATTTGATGGTGATTATTT No data
Right 1108970932 13:56375635-56375657 TTTCTAATCAAACTAAAAGAGGG No data
1108970929_1108970932 8 Left 1108970929 13:56375604-56375626 CCCATAATTTGATGGTGATTATT No data
Right 1108970932 13:56375635-56375657 TTTCTAATCAAACTAAAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108970932 Original CRISPR TTTCTAATCAAACTAAAAGA GGG Intergenic
No off target data available for this crispr