ID: 1108975385

View in Genome Browser
Species Human (GRCh38)
Location 13:56437215-56437237
Sequence GAAAATGGAGAGATGTAGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108975383_1108975385 -3 Left 1108975383 13:56437195-56437217 CCAAGGGCATGAGTCGGGGAGAA No data
Right 1108975385 13:56437215-56437237 GAAAATGGAGAGATGTAGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108975385 Original CRISPR GAAAATGGAGAGATGTAGTT TGG Intergenic
No off target data available for this crispr