ID: 1108992844

View in Genome Browser
Species Human (GRCh38)
Location 13:56684948-56684970
Sequence ATTGATAGAGGCTGGAGTTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108992844_1108992850 25 Left 1108992844 13:56684948-56684970 CCAAAACTCCAGCCTCTATCAAT No data
Right 1108992850 13:56684996-56685018 CCACATAATGCTTATCAACAAGG No data
1108992844_1108992851 26 Left 1108992844 13:56684948-56684970 CCAAAACTCCAGCCTCTATCAAT No data
Right 1108992851 13:56684997-56685019 CACATAATGCTTATCAACAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108992844 Original CRISPR ATTGATAGAGGCTGGAGTTT TGG (reversed) Intergenic
No off target data available for this crispr