ID: 1108992845

View in Genome Browser
Species Human (GRCh38)
Location 13:56684956-56684978
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108992845_1108992851 18 Left 1108992845 13:56684956-56684978 CCAGCCTCTATCAATTTACCTTT No data
Right 1108992851 13:56684997-56685019 CACATAATGCTTATCAACAAGGG No data
1108992845_1108992850 17 Left 1108992845 13:56684956-56684978 CCAGCCTCTATCAATTTACCTTT No data
Right 1108992850 13:56684996-56685018 CCACATAATGCTTATCAACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108992845 Original CRISPR AAAGGTAAATTGATAGAGGC TGG (reversed) Intergenic
No off target data available for this crispr